Paradigmatic pragmatism and the politics of diversity

How migration and mobilizations of difference are accommodated at the local level is a burning question. Concepts adopted by local governments and the capacities of cities to formulate and implement these have received increasing attention, but often without examining the ideas and norms that underlie local concepts and practices. This article assesses the hypothesis of local-level pragmatism, which it rejects, and develops the notion of ‘paradigmatic pragmatism’ to characterize how local-level politics address mobilizations of difference. Based on empirical findings from Amsterdam, Antwerp and Leeds, and comparing the content and the implementation of ‘diversity policies’, I argue against a dichotomy of pragmatic vs ideational politics. Instead, these cities draw on a variety of ideas and pragmatically combine them under the header of diversity. This paradigmatic pragmatism invites further research on the effects of potential incompatibilities of immigrant policy ideas.     

‘Have you got the Britísh?’: narratives of migration and settlement among Albanian-origin immigrants in London

Studies on migration and integration in Britain have noted the paucity of research on ‘new’ migrants, especially ‘illegal’ migrants and asylum seekers. This paper focuses on one understudied group – Albanian immigrants and their children – and looks at their migration and settlement, based on sixty interviews conducted in two phases either side of a 2003 mini-amnesty that gave many indefinite leave to remain. This regularization is the fulcrum around which our analytical narrative is built. Focusing on the interaction of migrants' agency with host-country structure, the paper shows that an unsettled asylum policy and delays in implementation have had deleterious effects on migrants' integration and sense of belonging, even after citizenship acquisition. As they search for a social and ethnic positioning within a multi-ethnic host society, the eventual realization of Albanians' migration project is accompanied by culture shock, intergenerational difference and ambivalence towards integration.     

Transnational family ties of immigrants in the Netherlands

Inspired by recent efforts in the United States to quantify the degree of transnational ties that immigrants possess, this article explores and analyses the prevalence and determinants of transnational family ties of immigrants in the Netherlands. Using data from a representative survey of four immigrant groups in the Netherlands, this paper also aims to fill the gap in knowledge regarding the effects of incorporation into an immigrant's host society on transnational family ties. Findings show that, while the vast majority of immigrants with relatives in the country of origin have frequent contact with these relatives, only a third of respondents contribute to the livelihood of family members in the homeland. Incorporation characteristics show distinct patterns over different types of involvement. While incorporation variables have a negative effect on the frequency of contact, they show little effect on remittances.     

Denmark between liberalism and nationalism

Abstract

What explains the restrictive turn towards immigrants in European countries like Denmark? Are countries returning to nationalism, or are they following a general European trend towards a perfectionist, even ‘repressive’ liberalism that seeks to create ‘liberal people’ out of immigrants? Recent developments in Danish policies of integration and citizenship, education and anti-discrimination suggest a combination of these two diagnoses. The current Danish ‘integration philosophy’ leaves behind a previous concern with private choice and equal rights and opportunities to emphasize other historical elements, especially the duty to participate in upholding democracy and the egalitarian welfare community, and to promote autonomous and secular ways of life. However, the virtues of this ‘egalitarian republicanism’ are seen by right-of-centre intellectuals and politicians as rooted in a wider Christian national culture that immigrants must acquire in order to become full citizens.     

Gender identity and integration: second-generation Somali immigrants navigating gender in Canada

Many right-leaning politicians claim that normative Islamic perspectives on gender are at odds with the Western values and act as barriers to immigrant integration. Our interviews with 256 second-generation Somali-Canadians, however, suggest that gender-egalitarian identities are achieved – they are constructed and deployed by our participants to practice integration and express belonging in Canada. In this study, we move beyond analysis of attaining gender-egalitarian roles as a result of immigration and propose an understanding of gender as a form of Bourdieusian cultural capital that, depending on social values, functions as symbolic capital rendering individuals and groups as advantaged or disadvantaged. We, therefore, analyse modalities of “doing” gender as potential strategies of accumulating capital in furthering successful integration. Our study contributes to the emergent literature in migration studies that examines gender in relation to ethnic and national identities, and the extent to which it may impact integration experiences of second-generation Muslim immigrants.     

From ethnic minorities to ethnic majority policy: Multiculturalism and the shift to assimilationism in the Netherlands

Abstract

Recently in numerous European countries of immigration, there has been a widespread ‘moral panic’ about immigrants and ethnic diversity. In The Netherlands, a backlash has occurred in policy and in public discourse, with migrants being blamed for not meeting their responsibility to integrate and for practising ‘backward religions’. Why is it that a self-defined ‘liberal’ and ‘tolerant’ society demands conformity, compulsion and introduces seemingly undemocratic sanctions towards immigrants in a move towards assimilationism? These issues are analysed by providing an overview of modes of incorporation of immigrants in the Netherlands and it presents evidence on the socio-economic situation of immigrants. The article argues that patterns of disadvantage cannot be explained solely by the low human capital attributes of the original immigrants. In spite of multiculturalism, the causes have to be sought in pervasive institutional discrimination and the persistence of a culture of racism. The study argues that a shift to assimilation is more likely to create further societal divisions.     

Assimilation without groups?

In “Origins and Destinations”, Luthra, Soehl and Waldinger aim at “extending the canon” in research on immigrant integration. They do so by studying group and individual level characteristics across a large number of origin groups, thereby replacing group labels with theoretically relevant variables at the group level. In this review, three challenges in this endeavour are discussed: First of all, the analyses do not allow to disentangle the impact of group and individual level characteristics for all variables alike. Secondly, a primary data collection more tailored to the specifics of their conceptual framework is needed. This would many conclusions about how contexts of emigration and immigration truly matter above and beyond individual characteristic on a more solid ground. And third, the authors’ aim to abandon the use of origin group categories in empirical research on immigrant integration may come at a price.     

Challenging the racialization of child sexual exploitation: Muslim men,racism and belonging in Rotherham

This paper presents findings from original research exploring the impact on Muslim men of a child sexual exploitation scandal that attracted significant attention to the northern English town where they live and contributed to a sustained detrimental effect on local community relations. It foregrounds men’s accounts to reveal their agency and resilience in responding to racism that they identified as resulting from the scandal. It reveals how their accounts disrupt dominant discourses foregrounding Muslim self-segregation and lack of integration, demonstrating positive attachments and claims to localized space, and commitment to belonging. In doing so, it shows how men’s responses to racism challenge racialized forms of knowledge about Muslims. The paper draws attention to the significance of localized forms of belonging in facilitating the inclusion of Muslim minorities. It also highlights the importance of centring Muslim men as historically speaking subjects in accounts of issues involving them.     

Viral/plasmid captures in Crenarchaea

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.     

Population-response model for vibrotactile spatial summation

A computational model based on previous physiological and psychophysical data is presented for the human Pacinian (P) psychophysical channel. The model can predict the probability of detection in simple psychophysical tasks, and hence psychometric functions and thresholds. The model simulates stimulating variable and fixed glabrous skin sites with different-sized contactors and includes spatial variation of monkey P-fiber sensitivities. Therefore, it is especially suitable for studying spatial summation, i.e. the improvement of threshold with increasing contactor area. Selective contributions of neural integration (n.i.) and probability summation (p.s.) are also incorporated into the model. Model predictions are compared to psychophysical results of Gescheider et al. (). The performance of the model regarding the effects of contactor size is very good. In addition to predicting approximately 3?dB improvement of thresholds when the contactor area is doubled, the model also reveals nonlinear contributions of p.s. and n.i. Furthermore, the model asserts that thresholds are largely governed by neural integration when small contactors are used. These and other findings discussed in the article show that the presented model is a helpful tool for formulating testable hypotheses. Although the model can also simulate some temporal summation effects, simulation results do not conform well to previous data on temporal response properties. Thus, the model needs to be refined in that respect.